 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circHIPK3 | |||
| Gene | HIPK3 | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Osteosarcoma | ICD-10 | Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41) |
| DBLink | Link to database | PMID | 29805712 |
| Experimental Method | |||
| Sample Type | Osteosarcoma cell lines, tissues and plasmas | Comparison | 50 patients with osteosarcoma before surgery, other 10 patients with benign bone tumor (four cases of osteoclastoma, six cases of fibrous dysplasia) and 20 age- and sex-matched healthy individuals as the control group. |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward TGGAGACTGGGGGAAGATGA ReverseCACACTAACTGGCTGAGGGG | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Xiao-Long, M, Kun-Peng, Z, Chun-Lin, Z (2018). Circular RNA circ_HIPK3 is down-regulated and suppresses cell proliferation, migration and invasion in osteosarcoma. J Cancer, 9, 10:1856-1862. | |||